Prev. |  KEGG KO K03108 > 

RIKEN DNA Bank Human Resource - SRP72

Gene ID NCBI Gene 6731 |  KEGG hsa:6731
Gene Symbol SRP72
Protein Name signal recognition particle 72
Synonyms BMFF|BMFS1|HEL103
Ortholog resource in our bank

  SRP72

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX042941 IRAK107F21 pCMV-SPORT6 BC046143 NM_006947 Partial/var
HGX047688 IRAK119D16 pCMV-SPORT6 BC056901 NM_006947 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR059226 ARe48B02 pKA1U5 NM_006947.3  
GGCCCCTCGTCTCCTCCAAGATGGCGAGCGGCGGCAGCGGGGGGGTGTCAGTACCTGCGC
HKR264639 ARiS161J23 pGCAP10 NM_006947.3  
GCCTCCAAGATGGCGAGCGGCGGCAGCGGGGGGGTGTCAGTACCTGCGCTGTGGAGTGAA
HKR361730 RBd04F10 pGCAP10 NM_006947.3  
GGCCCCTCGTCTCCTCCAAGATGGCGAGCGGCGGCAGCGGGGGGGTGTCAGTACCTGCGC
HKR402923 RBdS007F03 pGCAP10 NM_006947.3  
GGCCCCGCCCCTCGTCTCCTCCAAGATGGCGAGCGGCGGCAGCGGGGGGGTGTCAGTACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl