Prev. |  KEGG KO K03107 > 

RIKEN DNA Bank Human Resource - SRP68

Gene ID NCBI Gene 6730 |  KEGG hsa:6730
Gene Symbol SRP68
Protein Name signal recognition particle 68
Synonyms -
Ortholog resource in our bank

  SRP68

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY096335 IRAL040N23 pOTB7 BC020238 NM_014230 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR075607 ARe89A07 pKA1U5 NM_014230.2  
GGCGGCGCAGGGGCAAGATGGCTGCTGAGAAGCAGGTCCCAGGCGGCGGCGGCGGCGGCG
HKR260130 ARiS150F10 pGCAP10 NM_014230.2  
TGGCGNNNCNNGGNCAATATGGCTGCTGAGAAGCANGTCCCAGGCGGCGGCGGCGGCNGC
HKR334459 RBb36C11 pGCAP1 NM_014230.2  
GAGGGGCAAGATGGCTGCTGAGAAGCAGGTCCCAGGCGGCGGCGGCGGCGGCGGCAGTGG
HKR360834 RBd02B10 pGCAP10 NM_014230.2  
GGGGGCAAGATGGCTGCTGAGAAGCAGGTCCCAGGCGGCGGCGGCGGCGGCGGCAGTGGC
HKR405536 RBdS013N24 pGCAP10 NM_014230.2  
GCCCCCGTCTTGCTCTGCGGCGCAGGGGCAAGATGGCTGCTGAGAAGCAGGTCCCAGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl