Prev. |  KEGG KO K03106 > 

RIKEN DNA Bank Human Resource - SRP54

Gene ID NCBI Gene 6729 |  KEGG hsa:6729
Gene Symbol SRP54
Protein Name signal recognition particle 54
Synonyms -
Ortholog resource in our bank

  SRP54

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001354 IRAK003G10 pCMV-SPORT6 BC003389 NM_003136
HGY082267 IRAL005L03 pOTB7 BC000652 NM_003136 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR169721 ARi24F01 pGCAP10 NM_003136.3  
GATTGGGCGGAAGGTTCGCTGGCACTCCGTTGGTCTTCCAGCTGGTGGGAGTTGACGACG
HKR238465 ARiS096C17 pGCAP10 NM_003136.3  
AAAGGTTGGTCTTCCAGCTGGTGGGAGTTGACGACGTGGTGCTGGGCGTTGGGACCCTAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl