Prev. |  KEGG KO K04378 > 

RIKEN DNA Bank Human Resource - SRF

Gene ID NCBI Gene 6722 |  KEGG hsa:6722
Gene Symbol SRF
Protein Name serum response factor
Synonyms MCM1
Ortholog resource in our bank

  SRF

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY097916 IRAL044N04 pOTB7 BC048211 NM_003131 Full
HGY099098 IRAL047M10 pOTB7 BC052572 NM_003131 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR260188 ARiS150H20 pGCAP10 NM_003131.2  
GGCGCGGCCTGGGGCaaCCCGGGCCACAGGGGCAGGAAAGTGAGGGCCCAGGTCGGCCCG
HKR385230 RBd63B06 pGCAP10 NM_003131.2  
GCTGGGGCAACCCGGGCCACAGGGGCAGGAAAGTGAGGGCCCAGGTCGGCCCGGGCGTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl