Prev. |  KEGG KO K09107 > 

RIKEN DNA Bank Human Resource - SREBF2

Gene ID NCBI Gene 6721 |  KEGG hsa:6721
Gene Symbol SREBF2
Protein Name sterol regulatory element binding transcription factor 2
Synonyms SREBP-2|SREBP2|bHLHd2
Ortholog resource in our bank

  SREBF2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05498 pKM2L-phSREBP2 Promoter Bank clone, Human sterol regulatory element-binding protein-2 (SREBP-2) promoter

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX042938 IRAK107F18 pCMV-SPORT6 BC051799 NM_004599 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR248826 ARiS122B02 pGCAP10 NM_004599.2  
GGCCCTTTCTGTGCGGCGCCCGGGCGCAACGCAAACATGGCGGCGGGTGGCACCCGTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl