Prev. |  KEGG KO K06115 > 

RIKEN DNA Bank Human Resource - SPTBN1

Gene ID NCBI Gene 6711 |  KEGG hsa:6711
Gene Symbol SPTBN1
Protein Name spectrin beta, non-erythrocytic 1
Synonyms ELF|HEL102|SPTB2|betaSpII
Ortholog resources KEGG ortholog (KEGG orthology K06115) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR235221 ARiS088A21 pGCAP10 NM_003128.2  
GAGTCCCTCCCTCGGCCGCCTCTCCTCCCGGAGCGAGCGCGCAGCCCTGCGCAGCAGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl