RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - SPTBN1

Gene ID	NCBI Gene 6711 \| KEGG hsa:6711
Gene Symbol	SPTBN1
Protein Name	spectrin beta, non-erythrocytic 1
Synonyms	ELF\|HEL102\|SPTB2\|betaSpII
Ortholog resources	KEGG ortholog (KEGG orthology K06115) in the DNA Bank

Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	mRNA RefSeqs/DDBJ accession⁽¹⁾
Catalog number	5'-terminal sequence⁽²⁾
HKR235221	ARiS088A21	pGCAP10	NM_003128.2
HKR235221	GAGTCCCTCCCTCGGCCGCCTCTCCTCCCGGAGCGAGCGCGCAGCCCTGCGCAGCAGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv

2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl