Prev. |  KEGG KO K00072 > 

RIKEN DNA Bank Human Resource - SPR

Gene ID NCBI Gene 6697 |  KEGG hsa:6697
Gene Symbol SPR
Protein Name sepiapterin reductase
Synonyms SDR38C1
Ortholog resource in our bank

  SPR

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY095956 IRAL039O20 pOTB7 BC017310 NM_003124

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100816 M01C052A16 pDONR221 MGC15-F08 BC017310 NM_003124  
HGE100864 M01C052C16 pDONR221 MGC15-F08 BC017310 NM_003124  
HGE100912 M01C052E16 pDONR221 MGC15-F08 BC017310 NM_003124  
HGE100960 M01C052G16 pDONR221 MGC15-F08 BC017310 NM_003124  
HGE101008 M01C052I16 pDONR221 MGC15-F08 BC017310 NM_003124  
HGE101056 M01C052K16 pDONR221 MGC15-F08 BC017310 NM_003124  
HGE101104 M01C052M16 pDONR221 MGC15-F08 BC017310 NM_003124  
HGE101152 M01C052O16 pDONR221 MGC15-F08 BC017310 NM_003124  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR024550 ARa61G06 pKA1U5 NM_003124.4  
TTGGGAGAACAGGAGCATGGAGGGCGGGCTGGGGCGTGCTGTGTGCTTGCTGACCGGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl