Prev. |  KEGG KO K13254 > 

RIKEN DNA Bank Human Resource - SPAST

Gene ID NCBI Gene 6683 |  KEGG hsa:6683
Gene Symbol SPAST
Protein Name spastin
Synonyms ADPSP|FSP2|SPG4
Ortholog resource in our bank

  SPAST

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR205252 ARiS013C04 pGCAP10 NM_014946.3  
GGTTTGTAGGCTTCNCGCTGCTGCGTTTGGTCGCCTTCCACCTGGGGCTCCTCTTCGTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl