Prev. | 

RIKEN DNA Bank Human Resource - SPAG4

Gene ID NCBI Gene 6676 |  KEGG hsa:6676
Gene Symbol SPAG4
Protein Name sperm associated antigen 4
Synonyms CT127|SUN4
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR081753 ARf04G09 pKA1U5 NM_003116.1  
GGAGAGACTTCCCAGCTGTCTGGCTTGTGGACTGAGCAATCTGCGGCCCGGTCTCGAGGG
HKR260109 ARiS150E13 pGCAP10 NM_003116.1  
GTTCCTGTTCACGGCTGTGTCGCTGCTGAGCCTCTTTCTGTCAGCATTCTGGCTGGGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl