Prev. |  KEGG KO K09268 > 

RIKEN DNA Bank Human Resource - SOX4

Gene ID NCBI Gene 6659 |  KEGG hsa:6659
Gene Symbol SOX4
Protein Name SRY-box 4
Synonyms EVI16
Ortholog resources KEGG ortholog (KEGG orthology K09268) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB17311 CSII-EF-IRES2-Venus_hSOX4 Lentivirus expression vector of human Sox4.
RDB17312 CSII-EF-IRES2-Venus_hSOX4 deltaN56 Lentivirus expression vector of human Sox4, truncated N-teminus (2 aa - 56 aa).
RDB17313 CSII-EF-IRES2-Venus_hSOX4 deltaHMG Lentivirus expression vector of human Sox4, truncated HMG domain (57 aa - 133 aa).
RDB17314 CSII-EF-IRES2-Venus_hSOX4 deltaGRR Lentivirus expression vector of human Sox4, truncated GRR (134 aa - 227 aa).
RDB17315 CSII-EF-IRES2-Venus_hSOX4 deltaSRR Lentivirus expression vector of human Sox4, truncated SRR (228 aa - 397 aa).
RDB17316 CSII-EF-IRES2-Venus_hSOX4 deltaC33 Lentivirus expression vector of human Sox4, truncated TAD (C-teminus, 442 aa - 474 aa).
RDB17317 CSII-EF-IRES2-Venus_hSOX4 deltaC52 Lentivirus expression vector of human Sox4, truncated TAD (C-teminus, 423 aa - 474 aa).
RDB17319 CSU6EG_sh7D-hSOX4 Short hairpin RNA (shRNA) lentivirus expression vector of human Sox4.

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY100354 IRAL050O18 pOTB7 BC072668 NM_003107 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR066899 ARe67E03 pKA1U5 NM_003107.2  
GGCTCTAAGCTGCAGCAAGAGAAACTGTGTGTGAGGGGAAGAGGCCTGTTTCGCTGTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.07.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl