DNA Bank Top |  KEGG KO K09268 > 

RIKEN DNA Bank Human Resource - SOX4

Gene ID NCBI Gene 6659 |  KEGG hsa:6659
Gene Symbol SOX4
Protein Name SRY-box transcription factor 4
Synonyms CSS10|EVI16

Link

Ortholog resource in our bank

  SOX4


External database

human SOX4

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB17319 CSU6EG_sh7D-hSOX4 Short hairpin RNA (shRNA) lentivirus expression vector of human Sox4.    
RDB17317 CSII-EF-IRES2-Venus_hSOX4 deltaC52 Lentivirus expression vector of human Sox4, truncated TAD (C-teminus, 423 aa - 474 aa).    
RDB17316 CSII-EF-IRES2-Venus_hSOX4 deltaC33 Lentivirus expression vector of human Sox4, truncated TAD (C-teminus, 442 aa - 474 aa).    
RDB17315 CSII-EF-IRES2-Venus_hSOX4 deltaSRR Lentivirus expression vector of human Sox4, truncated SRR (228 aa - 397 aa).    
RDB17314 CSII-EF-IRES2-Venus_hSOX4 deltaGRR Lentivirus expression vector of human Sox4, truncated GRR (134 aa - 227 aa).    
RDB17313 CSII-EF-IRES2-Venus_hSOX4 deltaHMG Lentivirus expression vector of human Sox4, truncated HMG domain (57 aa - 133 aa).    
RDB17312 CSII-EF-IRES2-Venus_hSOX4 deltaN56 Lentivirus expression vector of human Sox4, truncated N-teminus (2 aa - 56 aa).    
RDB17311 CSII-EF-IRES2-Venus_hSOX4 Lentivirus expression vector of human Sox4.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY100354 IRAL050O18 pOTB7 BC072668 NM_003107 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR066899 ARe67E03 pKA1U5 NM_003107.2  
GGCTCTAAGCTGCAGCAAGAGAAACTGTGTGTGAGGGGAAGAGGCCTGTTTCGCTGTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.12.10

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl