RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - SOX4

Gene ID	NCBI Gene 6659 \| KEGG hsa:6659
Gene Symbol	SOX4
Protein Name	SRY-box transcription factor 4
Synonyms	CSS10\|EVI16

Ortholog resource in our bank

  SOX4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number	Name of Resource	Description
RDB17311	CSII-EF-IRES2-Venus_hSOX4	Lentivirus expression vector of human Sox4.
RDB17312	CSII-EF-IRES2-Venus_hSOX4 deltaN56	Lentivirus expression vector of human Sox4, truncated N-teminus (2 aa - 56 aa).
RDB17313	CSII-EF-IRES2-Venus_hSOX4 deltaHMG	Lentivirus expression vector of human Sox4, truncated HMG domain (57 aa - 133 aa).
RDB17314	CSII-EF-IRES2-Venus_hSOX4 deltaGRR	Lentivirus expression vector of human Sox4, truncated GRR (134 aa - 227 aa).
RDB17315	CSII-EF-IRES2-Venus_hSOX4 deltaSRR	Lentivirus expression vector of human Sox4, truncated SRR (228 aa - 397 aa).
RDB17316	CSII-EF-IRES2-Venus_hSOX4 deltaC33	Lentivirus expression vector of human Sox4, truncated TAD (C-teminus, 442 aa - 474 aa).
RDB17317	CSII-EF-IRES2-Venus_hSOX4 deltaC52	Lentivirus expression vector of human Sox4, truncated TAD (C-teminus, 423 aa - 474 aa).
RDB17319	CSU6EG_sh7D-hSOX4	Short hairpin RNA (shRNA) lentivirus expression vector of human Sox4.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGY100354	IRAL050O18	pOTB7	BC072668	NM_003107	Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR066899	ARe67E03	pKA1U5	NM_003107.2
HKR066899	GGCTCTAAGCTGCAGCAAGAGAAACTGTGTGTGAGGGGAAGAGGCCTGTTTCGCTGTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl