Prev. | Human A to Z list > S > 

RIKEN DNA Bank Human Resource - SOS2

Gene ID (NCBI) 6655
Gene Symbol SOS2
Protein Name SOS Ras/Rho guanine nucleotide exchange factor 2
Synonyms NS9|SOS-2
Databases KEGG hsa:6655 |  NCBI Gene 6655
Featured content Jak-STAT signaling pathway (human)
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K03099)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR406015 RBdS015A15 pGCAP10 NM_006939.2  
GAGAAGCGGGCCAGCGCCGCCGGGAAAGGAGGTCGCCGCCCGGGGTCGCCCGGGCTTGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl