Prev. |  KEGG KO K03099 > 

RIKEN DNA Bank Human Resource - SOS2

Gene ID NCBI Gene 6655 |  KEGG hsa:6655
Gene Symbol SOS2
Protein Name SOS Ras/Rho guanine nucleotide exchange factor 2
Synonyms NS9|SOS-2
Featured content Jak-STAT signaling pathway (human)
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Ortholog resource in our bank

  SOS2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR406015 RBdS015A15 pGCAP10 NM_006939.2  
GAGAAGCGGGCCAGCGCCGCCGGGAAAGGAGGTCGCCGCCCGGGGTCGCCCGGGCTTGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl