Prev. |  KEGG KO K00008 > 

RIKEN DNA Bank Human Resource - SORD

Gene ID NCBI Gene 6652 |  KEGG hsa:6652
Gene Symbol SORD
Protein Name sorbitol dehydrogenase
Synonyms HEL-S-95n|RDH|SDH|SORD1|XDH
Ortholog resource in our bank

  SORD

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081398 IRAL003I06 pOTB7 BC021085 NM_003104
HGY097137 IRAL042O01 pOTB7 BC025295 NM_003104 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR186173 ARi65H05 pGCAP10 NM_003104.4  
GGCCCTGGACCCTCGGCTGGGTAGCGCCACCAGAGCGACCAAACGTCCCGCGCCTTCCAG
HKR403102 RBdS007M14 pGCAP10 NM_003104.4  
GAGGCCCCACCTTCCATCCAGTGCCCTGGACCCTCGGCTGGGTAGCGCCACCAGAGCGAC
HKR444158 RBdS110G14 pGCAP10 NM_003104.4  
GGCCCTGGACCCTCGGCTGGGTAGCGCCACCAGAGCGACCAAACGTCCCGCGCCTTCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl