DNA Bank Top |  KEGG KO K04565 > 

RIKEN DNA Bank Human Resource - SOD1

Gene ID NCBI Gene 6647 |  KEGG hsa:6647
Gene Symbol SOD1
Protein Name superoxide dismutase 1
Synonyms ALS|ALS1|HEL-S-44|IPOA|SOD|STAHP|hSod1|homodimer
Featured content Huntington disease - human
Featured content Amyotrophic lateral sclerosis (ALS) - human

Link

Ortholog resource in our bank

  SOD1


External database

human SOD1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB13394 pGEX6p-1-SOD1_G93A E coli expression vector for GST-fused human G93A SOD1. (IPTG induction)    
RDB13393 pGEX6p-1-SOD1_WT E coli expression vector for GST-fused human SOD1. (IPTG induction)    
RDB13392 pEGFP-SOD1_G93A Mammalian expression vector for human G93A SOD1 with EGFP tag at C-terminus.    
RDB13391 pEGFP-SOD1_G85R Mammalian expression vector for human G85R SOD1 with EGFP tag at C-terminus.    
RDB13390 pEGFP-SOD1_WT Mammalian expression vector for human SOD1 with EGFP tag at C-terminus.    
RDB13388 pcDNA3-SOD1-FLAG_G93A Mammalian expression vector for human G93A SOD1 with FLAG tag at C-terminus.    
RDB13387 pcDNA3-SOD1-FLAG_G85R Mammalian expression vector for human G85R SOD1 with FLAG tag at C-terminus.    
RDB13386 pcDNA3-SOD1-FLAG_WT Mammalian expression vector for human SOD1 with FLAG tag at C-terminus.    
RDB07686 pGL4-phSOD1 Promoter collection, Human SOD1 promoter    
RDB05190 pAxCALNLhSOD1 (reverse) Shuttle vector to generate rAd harboring human SOD1 (reverse)    
RDB05189 pAxCALNLhSOD1 (forward) Shuttle vector to generate rAd harboring human SOD1 (forward)    
RDB05081 pAxCALNLhSOD1(reverse) Shuttle vector to generate rAd expressing human SOD1    
RDB05080 pAxCALNLhSOD1(forward) Shuttle vector to generate rAd expressing human SOD1    
RDB05077 pAxCALNLhSOD1(reverse) Shuttle vector to generate rAd expressing human SOD1    
RDB05076 pAxCALNLhSOD1(forward) Shuttle vector to generate rAd expressing human SOD1    
RDB04094 pAxCALNLhSOD1 (reverse) Shuttle vector to generate rAd harboring human SOD1 (reverse)    
RDB03511 pAxCALNLhSOD1 (forward) Shuttle vector to generate rAd harboring human SOD1 (forward)    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081616 IRAL004A16 pOTB7 BC001034 NM_000454 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE040289 W01A100M01 pENTR-TOPO IRAL004A16 BC001034 NM_000454  
HGE040295 W01A100M07 pENTR-TOPO IRAL004A16 BC001034 NM_000454  
HGE050678 W01A126L14 pENTR-TOPO IRAL004A16 BC001034 NM_000454  
HGE050684 W01A126L20 pENTR-TOPO IRAL004A16 BC001034 NM_000454  
HGE050688 W01A126L24 pENTR-TOPO IRAL004A16 BC001034 NM_000454  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044507 ARe11E11 pKA1U5 NM_000454.4  
GCGTCGTAGTCTCCTGCAGCGTCTGGGGTTTCCGTTGCAGTCCTCGGAACCAGGACCTCG
HKR045377 ARe13H09 pKA1U5 NM_000454.4  
GGCGTCGTAGTCTCCTGCAGCGTCTGGGGTTTCCGTTGCAGTCCTCGGAACCAGGACCTC
HKR054907 ARe37E11 pKA1U5 NM_000454.4  
TGGTTTGCGTCGTAGTCTCCTGCAGCGTCTGGGGTTTCCGTTGCAGTCCTCGGAACCAGG
HKR060104 ARe50E08 pKA1U5 NM_000454.4  
GCGTCGTAGTCTCCTGCAGCGTCTGGGGTTTCCGCTTGCAGTCCTCGGAACCAGGACCTC
HKR075282 ARe88D10 pKA1U5 NM_000454.4  
GCGTCGTAGTCTCCTGCAGCGTCTGGGGTTTCCGTTGCAGTCCTCGGAACCAGGACCTCG
HKR169724 ARi24F04 pGCAP10 NM_000454.4  
GTTGCGTCGTAGTCTCCTGCAGCGTCTGGGGTTTCCGTTGCAGTCCTCGGAACCAGGACC
HKR174879 ARi37D07 pGCAP10 NM_000454.4  
GGCGTCGTAGTCTCCTGCAGCGTCTGGGGTTTCCGTTGCAGTCCTCGGAACCAGGACCTC
HKR187771 ARi69H03 pGCAP10 NM_000454.4  
GGTCGTAGTCTCCTGCAGCGTCTGGGGTTTCCGTTGCAGTCCTCGGAACCAGGACCTCGG
HKR203537 ARiS008O01 pGCAP10 NM_000454.4  
GGCGTCGTAGTCTCCTGCAGCGTCTGGGGTTTCCGTTGCAGTCCTCGGAACCAGGACCTC
HKR222315 ARiS055N03 pGCAP10 NM_000454.4  
GGGTTTGCGTCNTANTCTCCTGCNNCNNCTGGGGTTTCCGTTGCAGTCCTCGGAACCAGG
HKR323227 RBb08B03 pKA1U5 NM_000454.4  
TTTTTGCGTCGTAGTCTCCTGCAGCGTCTGGGGCTTTCCGTTGCAGTCCTCGGAACCAGG
HKR331206 RBb28A06 pGCAP1 NM_000454.4  
GAGTCGCGGAGACGGGGTGCTGGTTTGCGTCGTAGTCTCCTGCAGCGTCTGGGGTTTCCG
HKR331304 RBb28E08 pGCAP1 NM_000454.4  
TTGTTTGCGTCGTAGTCTCCTGCAGCGTCTGGGGTTTCCGTTGCAGTCCTCGGAACCAGG
HKR343684 RBb59D12 pGCAP1 NM_000454.4  
GGGAACCAGGACCTCGGCGTGGCCTAGCGAGTTATGGCGACGAAGGCCGTGTGCGTGCTG
HKR348009 RBb70A09 pGCAP1 NM_000454.4  
GAGTCGCGGAAGACGGGGTGCTGGTTTGCGTCGTAGTCTCCTGCAGCGTCTGGGGTTTCC
HKR360831 RBd02B07 pGCAP10 NM_000454.4  
GGCAGTCCTCGGAACCAGGACCTCGGCGTGGCCTAGCGAGTTATGGCGACGAAGGCCGTG
HKR365273 RBd13D01 pGCAP10 NM_000454.4  
GGCGTCGTAGTCTCCTGCAGCGTCTGGGGTTTCCGTTGCAGTCCTCGGAACCAGGACCTC
HKR374856 RBd37C08 pGCAP10 NM_000454.4  
TTTTTTGCGTCGTAGTCTCCTGCAGCGTCTGGGGTTTCCGTTGCAGTCCTCGGAACCAGG
HKR374930 RBd37F10 pGCAP10 NM_000454.4  
GGCGTCGTAGTCTCCTGCAGCGTCTGGGGTTTCCGTTGCAGTCCTCGGAACCAGGACCTC
HKR430277 RBdS075L13 pGCAP10 NM_000454.4  
GGTTTGCGTCGTAGTCTCCTGCAGCGTCTGGGGTTTCCGTTGCAGTCCTCGGAACCAGGA
HKR433221 RBdS083A21 pGCAP10 NM_000454.4  
GATAAAGTAGTCGCGGAGACGGGGTGCTGGTTTGCGTCGTAGTCTCCTGCAGCGTCTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.10.04

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl