Prev. |  KEGG KO K11088 > 

RIKEN DNA Bank Human Resource - SNRPD3

Gene ID NCBI Gene 6634 |  KEGG hsa:6634
Gene Symbol SNRPD3
Protein Name small nuclear ribonucleoprotein D3 polypeptide
Synonyms SMD3|Sm-D3
Ortholog resource in our bank

  SNRPD3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080569 IRAL001H01 pOTB7 BC000457 NM_004175 Full
HGY083969 IRAL009P09 pOTB7 BC003150 NM_004175 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR043250 ARe08C02 pKA1U5 NM_004175.3  
GATTCGCTTGACTCACGCCTTCGCCGTAGCATCTTTCGCAGCGGACCGAAGAGAAGAAAA
HKR074922 ARe87F02 pKA1U5 NM_004175.3  
GCCCGCCATTCGCTTGACTCACGCCTTCGCCGCTAGCATCTTTCGCAGCGGACCGAAGAG
HKR166575 ARi16H07 pGCAP10 NM_004175.3  
GGCCATTCGCTTGACTCACGCCTTCGCCGTAGCATCTTTCGCAGCGGACCGAAGAGAAGA
HKR181259 ARi53C11 pGCAP10 NM_004175.3  
GAGGCCCGCCATTCGCTTGACTCACGCCTTCGCCGTAGCATCTTTCGCAGCGGACCGAAG
HKR205536 ARiS013N24 pGCAP10 NM_004175.3  
GGCCATTCGCTTGACTCACGCCTTCGCCGTAGCATCTTTCGCAGCGGACCGAAGAGAAGA
HKR222087 ARiS055D15 pGCAP10 NM_004175.3  
GAGGCCCGCCATTCGCTTGACTCACGCCTTCGCCGTAGCATCTTTCGCAGCGGACCGAAG
HKR247408 ARiS118I16 pGCAP10 NM_004175.3  
GAGAGTGGAATTCTGGGTGTTAGGCCCGCCATTCGCTTGACTCACGCCTTCGCCGTAGCA
HKR320808 RBb02A08 pKA1U5 NM_004175.3  
GATTCGCTTGACTCACGCCTTCGCCGTAGCATCTTTCGCAGCGGACCGAAGAGAAGAAAA
HKR361700 RBd04E04 pGCAP10 NM_004175.3  
GAGGCCCGCCATTCGCTTGACTCACGCCTTCGCCGTAGCATCTTTCGCAGCGGACCGAAG
HKR362475 RBd06D03 pGCAP10 NM_004175.3  
GCCGCCATTCGCTTGACTCACGCCTTCGCCGTAGCATCTTTCGCAGCGGACCGAAGAGAA
HKR387755 RBd69G11 pGCAP10 NM_004175.3  
GGTTAGGCCCGCCATTCGCTTGACTCACGCCTTCGCCGTAGCATCTTTCGCAGCGGACCG
HKR388460 RBd71C12 pGCAP10 NM_004175.3  
GGTTAGGCCCGCCATTCGCTTGACTCACGCCTTCGCCGTAGCATCTTTCGCAGCGGACCG
HKR388875 RBd72D03 pGCAP10 NM_004175.3  
GGCCATTCGCTTGACTCACGCCTTCGCCGTAGCATCTTTCGCAGCGGACCGAAGAGAAGA
HKR396128 RBd90F08 pGCAP10 NM_004175.3  
GATTCGCTTGACTCACGCCTTCGCCGTAGCATCTTTCGCAGCGGACCGAAGAGAAGAAAA
HKR406077 RBdS015D05 pGCAP10 NM_004175.3  
GATTCGCTTGACTCACGCCTTCGCCGTAGCATCTTTCGCAGCGGACCGAAGAGAAGAAAA
HKR408958 RBdS022G14 pGCAP10 NM_004175.3  
GGGGTGTTAGGCCCGCCATTCGCTTGACTCACGCCTTCGCCGTAGCATCTTTCGCAGCGG
HKR428009 RBdS070A09 pGCAP10 NM_004175.3  
GGTTAGGCCCGCCATTCGCTTGACTCACGCCTTCGCCGTAGCATCTTTCGCAGCGGACCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl