Prev. |  KEGG KO K11094 > 

RIKEN DNA Bank Human Resource - SNRPB2

Gene ID NCBI Gene 6629 |  KEGG hsa:6629
Gene Symbol SNRPB2
Protein Name small nuclear ribonucleoprotein polypeptide B2
Synonyms Msl1|U2B''
Ortholog resource in our bank

  SNRPB2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027817 IRAK069J01 pCMV-SPORT6 BC036737 NM_198220 Full
HGY089227 IRAL023B03 pOTB7 BC008311 NM_198220 Partial/var
HGY094381 IRAL035P21 pDNR-LIB BC018022 NM_198220 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE021362 W01A053G18 pENTR-TOPO IRAL035P21 BC018022 NM_198220  
HGE021368 W01A053G24 pENTR-TOPO IRAL035P21 BC018022 NM_198220  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044551 ARe11G07 pKA1U5 NM_003092.3  
GGCTTTTGGTTCTTACAGTAGTCGGCGTAGGCCTTAGGTGGGTTCGTGCGCCTTCTACCT
HKR078411 ARe96A11 pKA1U5 NM_003092.3  
GGCTCCGTTTCCTGCTTTTGGTTCTTACAGTAGTCGGCGTAGGCCTTAGGTGGGTTCGTG
HKR168948 ARi22G04 pGCAP10 NM_003092.3  
GGCCTGGCTCCGTTTCCTGCTTTTGGTTCTTACAGTAGTCGGCGTAGGCCTTAGATTTTT
HKR180951 ARi52G07 pGCAP10 NM_003092.3  
GGCCTGGCTCCGTTTCCTGCTTTTGGTTCTTACAGTAGTCGGCGTAGGCCTTAGATTTTT
HKR324474 RBb11D02 pKA1U5 NM_003092.3  
GCCGGTGCCTGGCTCCGTTTCCTGCTTTTGGTTCTTACAGTAGTCGGCGTAGGCCTTAGA
HKR361602 RBd04A02 pGCAP10 NM_003092.3  
GTTGGTTCTTACAGTAGTCGGCGTAGGCCTTAGGTGGGTTCGTGCGCCTTCTACCTCGCT
HKR376049 RBd40C01 pGCAP10 NM_003092.3  
GGCCTGGCTCCGTTTCCTGCTTTTGGTTCTTACAGTAGTCGGCGTAGGCCTTAGGTGGGT
HKR395226 RBd88B02 pGCAP10 NM_003092.3  
TGGCCTGGCTCCGTTTCCTGCTTTTGGTTCTTACAGTAGTCGGCGTAGGCCTTAGATTTT
HKR474956 RBdS187G12 pGCAP10 NM_003092.3  
AGGGCTTTTGGTTCTTACAGTAGTCGGCGTAGGCCTTAGGTGGGTTCGTGCGCCTTCTAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl