Prev. |  KEGG KO K11092 > 

RIKEN DNA Bank Human Resource - SNRPA1

Gene ID NCBI Gene 6627 |  KEGG hsa:6627
Gene Symbol SNRPA1
Protein Name small nuclear ribonucleoprotein polypeptide A'
Synonyms Lea1|U2A'
Ortholog resource in our bank

  SNRPA1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04501 SEREX clone BRC-Co-66 #1 SEREX clone BRC-Co-66 #1

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX066508 IRAK166E12 pCMV-SPORT6 BC071717 NM_003090 Full
HGY067395 IRAK168I03 pBluescriptR BC067846 NM_003090 Partial
HGY097058 IRAL042K18 pOTB7 BC022816 NM_003090 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE037231 W01A093B07 pENTR-TOPO IRAL042K18 BC022816 NM_003090  
HGE037237 W01A093B13 pENTR-TOPO IRAL042K18 BC022816 NM_003090  
HGE037243 W01A093B19 pENTR-TOPO IRAL042K18 BC022816 NM_003090  
HGE037245 W01A093B21 pENTR-TOPO IRAL042K18 BC022816 NM_003090  
HGE037273 W01A093D01 pENTR-TOPO IRAL042K18 BC022816 NM_003090  
HGE045626 W01A114B02 pENTR-TOPO IRAL042K18 BC022816 NM_003090  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR045679 ARe14D07 pKA1U5 NM_003090.2  
GGCCTGGCGGCGGGGCGCGGGGCACGCTGGGACGTCTCGCTGGCGGGAGGCCACGGGCTT
HKR361201 RBd03A01 pGCAP10 NM_003090.2  
GGCTCGCTGGGACGTCTCGCTGGCGGGAGGCCACGGGCTTTCCACAGCGCGGGGGAACGG
HKR474961 RBdS187G17 pGCAP10 NM_003090.2  
GGGGGCGCGGGGCACGCTGGGACGTCTCGCTGGCGGGAGGCCACGGGCTTTCCACAGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl