Prev. |  KEGG KO K11091 > 

RIKEN DNA Bank Human Resource - SNRPA

Gene ID NCBI Gene 6626 |  KEGG hsa:6626
Gene Symbol SNRPA
Protein Name small nuclear ribonucleoprotein polypeptide A
Synonyms Mud1|U1-A|U1A
Ortholog resource in our bank

  SNRPA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080646 IRAL001K06 pOTB7 BC000405 NM_004596
HGY087428 IRAL018J12 pOTB7 BC008290 NM_004596 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE005552 W01A013O16 pENTR-TOPO IRAL001K06 BC000405 NM_004596  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR388550 RBd71G06 pGCAP10 NM_004596.3  
GCTCTCCGCACGCGGGCTGGAGAAGCGGGTCCTACGCACGCTTTGTTGTCGCGCTTTGCC
HKR391772 RBd79H04 pGCAP10 NM_004596.3  
GGGAGAAGCGGGTCCTACGCACGCTTTGTTGTCGCGCTTTGCCTCCGTCCTTCCCCCTAC
HKR432548 RBdS081G04 pGCAP10 NM_004596.3  
GCTCTCCGCACGCGGGCTGGAGAAGCGGGTCCTACGCACGCTTTGTTGTCGCGCTTTGCC
HKR470831 RBdS177B07 pGCAP10 NM_004596.3  
GGAGAGTTCTCTCCGCACGCGGGCTGGAGAAGCGGGTCCTACGCACGCTTTGTTGTCGCG
HKR474988 RBdS187H20 pGCAP10 NM_004596.3  
TGGGGCTGGAGAAGCGGGTCCTACGCACGCTTTGTTGTCGCGCTTTGCCTCCGTCCTTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl