Prev. |  KEGG KO K17455 > 

RIKEN DNA Bank Human Resource - FSCN1

Gene ID NCBI Gene 6624 |  KEGG hsa:6624
Gene Symbol FSCN1
Protein Name fascin actin-bundling protein 1
Synonyms FAN1|HSN|SNL|p55
Ortholog resources KEGG ortholog (KEGG orthology K17455) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080666 IRAL001L02 pOTB7 BC000521 NM_003088 Full
HGY084313 IRAL010N01 pOTB7 BC007988 NM_003088 Full
HGY086857 IRAL017C09 pOTB7 BC006304 NM_003088 Full/var
HGY088268 IRAL020L04 pOTB7 BC007948 NM_003088 Full
HGY088928 IRAL022F08 pOTB7 BC007539 NM_003088 Full
HGY089411 IRAL023I19 pOTB7 BC007643 NM_003088 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR338026 RBb45B02 pGCAP1 NM_003088.2  
GGTGGAGCGCTGCGGAGGGTGCGTGCGGGCCGCGGCAGCCGAACAAAGGAGCAGGGGCGC
HKR340580 RBb51H12 pGCAP1 NM_003088.2  
AATGTGGGTGGAGCGCTGCGGAGGGTGCGTGCGGGCCGCTTNATCCGAACAAAGGAGCAG
HKR348850 RBb72C02 pGCAP1 NM_003088.2  
GGTGGAGCGCTGCGGAGGGTGCGTGCGGGCCGCGGCAGCCGAACAAAGGAGCAGGGGCGC
HKR348899 RBb72E03 pGCAP1 NM_003088.2  
GGTGGAGCGCTGCGGAGGGTGCGTGCGGGCCGCGGCAGCCGAACAAAGGAGCAGGGGCGC
HKR430258 RBdS075K18 pGCAP10 NM_003088.2  
GGTGGAGCGCTGCGGAGGGTGCGTGCGGGCCGCGGCAGCCGAACAAAGGAGCAGGGGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl