Prev. |  KEGG KO K15208 > 

RIKEN DNA Bank Human Resource - SNAPC1

Gene ID NCBI Gene 6617 |  KEGG hsa:6617
Gene Symbol SNAPC1
Protein Name small nuclear RNA activating complex polypeptide 1
Synonyms PTFgamma|SNAP43
Ortholog resource in our bank

  SNAPC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY092275 IRAL030L11 pOTB7 BC019038 NM_003082 Full
HGY093870 IRAL034L06 pOTB7 BC014984 NM_003082

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001603 W01A004A03 pENTR-TOPO IRAL030L11 BC019038 NM_003082  
HGE001613 W01A004A13 pENTR-TOPO IRAL034L06 BC014984 NM_003082  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040476 ARe01D04 pKA1U5 NM_003082.3  
GAGAGGCGTGCGGGCTTCGGAGGCGTGCGGGCTTCGGGTGCCATGGGGACTCCTCCCGGC
HKR045206 ARe13A06 pKA1U5 NM_003082.3  
GAGAGGCGTGCGGGCTTCGGAGGCGTGCGGGCTTCGGAGGCGTGCGGGCTTCGGAGGCGT
HKR060831 ARe52B07 pKA1U5 NM_003082.3  
GAGAGGCGTGCGGCCTTCGGANGCGTGCGGGCCTCNGGATGCCATGGGGACTCCTCCCGG
HKR205228 ARiS013B04 pGCAP10 NM_003082.3  
TAGAGAGGCGTGCGGGCTTCGGAGGCGTGCGGGCTTCGGAGGCGTGCGGGCTTCGGAGGC
HKR247464 ARiS118K24 pGCAP10 NM_003082.3  
GGCTGGCTAGTCCGTTAGAGGCGTGCGGGCTTCGGAGGCGTGCGGGCTTCGGAGGCGTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl