Prev. |  KEGG KO K12160 > 

RIKEN DNA Bank Human Resource - SUMO3

Gene ID NCBI Gene 6612 |  KEGG hsa:6612
Gene Symbol SUMO3
Protein Name small ubiquitin like modifier 3
Synonyms SMT3A|SMT3H1|SUMO-3|Smt3B
Ortholog resource in our bank

  SUMO3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083127 IRAL007N15 pOTB7 BC000036 NM_006936 Full
HGY088567 IRAL021G23 pDNR-LIB BC008420 NM_006936 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048449 ARe21C01 pKA1U5 NM_006936.2  
GACACAGTTGCGGCGGGAGAGCGGCGGGGCCGAGAGCGTGACTCGCCCGCTCCGCGCTGC
HKR058107 ARe45E11 pKA1U5 NM_006936.2  
GACAGTTGCGGCGGGAGAGCGGCGGGGCCGAGAGCTTGACTCGCCCGCTCCGCGCTGCTT
HKR180954 ARi52G10 pGCAP10 NM_006936.2  
GGTTCTGGACCTGCGGGAGGCAGACCGAGGGCGTCTGAGTTGAGGCCCCTTCCGATCCTG
HKR218257 ARiS045K17 pGCAP10 NM_006936.2  
GGCGGCCCCNCNCNCNNTNGCGGCGGGAGAGCGGCGGGGCCGAGAGCGTGACTCGCCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl