Prev. |  KEGG KO K12350 > 

RIKEN DNA Bank Human Resource - SMPD1

Gene ID NCBI Gene 6609 |  KEGG hsa:6609
Gene Symbol SMPD1
Protein Name sphingomyelin phosphodiesterase 1
Synonyms ASM|ASMASE|NPD
Featured content Sphingolipid signaling pathway (human)
Featured content Lysosome (human)
Ortholog resource in our bank

  SMPD1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033893 IRAK084M05 pCMV-SPORT6 BC041164 NM_001007593 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE014761 W01A036P01 pENTR-TOPO IRAK084M05 BC041164 NM_001007593  
HGE014765 W01A036P05 pENTR-TOPO IRAK084M05 BC041164 NM_001007593  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR222224 ARiS055J08 pGCAP10 NM_000543.3  
GAGAGAAGGGTAATCGGGTGTCCCCGGCGCCGCCCGGGGCCCTGAGGGCTGGCTAGGGTC
HKR277791 ARiS194H23 pGCAP10 NM_000543.3  
GAGAGAAGGGTAATCGGGTGTCCCCGGCGCCGCCCGGGGCCCTGAGGGCTGGCTAGGGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl