Prev. |  KEGG KO K11651 > 

RIKEN DNA Bank Human Resource - SMARCE1

Gene ID NCBI Gene 6605 |  KEGG hsa:6605
Gene Symbol SMARCE1
Protein Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1
Synonyms BAF57|CSS5
Ortholog resource in our bank

  SMARCE1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX053882 IRAK134L18 pCMV-SPORT6 BC063700 NM_003079 Full
HGX039558 IRAK098O22 pCMV-SPORT6 BC047731 NM_003079 Partial
HGY087935 IRAL019N23 pDNR-LIB BC011017 NM_003079 Full/var
HGY088465 IRAL021C17 pDNR-LIB BC007082 NM_003079 Full/var
HGY101841 IRAL054K01 pOTB7 BC069196 NM_003079 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE029468 W01A073L04 pENTR-TOPO flj0034p07 AK001532 NM_003079  
HGE029474 W01A073L10 pENTR-TOPO flj0034p07 AK001532 NM_003079  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR160506 ARi01E10 pGCAP10 NM_003079.4  
GGAGGGGCGGGGCGAGCGCGGGACAAAGGGAAGCGAAGCCGGAGCTGCGGGCGCTTTTTC
HKR184484 ARi61D12 pGCAP10 NM_003079.4  
CGGGAAGCTCCGGACGCGAGGGGCGGGGCGAGCGCGGGACAAAGGGAAGCGAAGCCGGAG
HKR219864 ARiS049K24 pGCAP10 NM_003079.4  
GGCGAGGGGCGGGGCGAGCGCGGGACAAAGGGAAGCGAAGCCGGAGCTGCGGGCGCTTTT
HKR322121 RBb05F01 pKA1U5 NM_003079.4  
ATCCTGGTGGAAAAGGGAAGCGAAGCCGGAGCTGCGGGCGCTTTTTCTGCCCGCGGTGTC
HKR375273 RBd38D01 pGCAP10 NM_003079.4  
GAGGGGCGGGGCGAGCGCGGGACAAAGGGAAGCGAAGCCGGAGCTGCGGGCGCTTTTTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl