Prev. |  KEGG KO K11650 > 

RIKEN DNA Bank Human Resource - SMARCD2

Gene ID NCBI Gene 6603 |  KEGG hsa:6603
Gene Symbol SMARCD2
Protein Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
Synonyms BAF60B|CRACD2|PRO2451|Rsc6p|SGD2
Ortholog resource in our bank

  SMARCD2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090759 IRAL026O23 pOTB7 BC018953 NM_003077 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE039309 W01A098E13 pENTR-TOPO IRAL026O23 BC018953 NM_003077  
HGE039317 W01A098E21 pENTR-TOPO IRAL026O23 BC018953 NM_003077  
HGE048449 W01A121C01 pENTR-TOPO IRAL026O23 BC018953 NM_003077  
HGE048455 W01A121C07 pENTR-TOPO IRAL026O23 BC018953 NM_003077  
HGE048459 W01A121C11 pENTR-TOPO IRAL026O23 BC018953 NM_003077  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR347284 RBb68D12 pGCAP1 NM_003077.3  
GGGAGTCCGGATCGCGGCACCGCGGGACGGGACGGAGCGATGTCGGGCCGAGGCGCGGGC
HKR363259 RBd08C11 pGCAP10 NM_003077.3  
GGAGCGCCGCCTCCCCCCGCGGGACCCGGCATGCTGCCCGGACCGGCGCTCCGGGGACCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl