Prev. |  KEGG KO K11649 > 

RIKEN DNA Bank Human Resource - SMARCC2

Gene ID NCBI Gene 6601 |  KEGG hsa:6601
Gene Symbol SMARCC2
Protein Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 2
Synonyms BAF170|CRACC2|CSS8|Rsc8
Ortholog resource in our bank

  SMARCC2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005042 IRAK012K02 pCMV-SPORT6 BC013045 NM_139067 Full/var
HGX005226 IRAK013B02 pCMV-SPORT6 BC009067 NM_003075 Partial
HGX010826 IRAK027B02 pCMV-SPORT6 BC026222 NM_003075 Full
HGY028037 IRAK070B13 pBluescriptR BC040645 NM_139067 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE009784 W01A024H16 pENTR-TOPO IRAK012K02 BC013045 NM_139067  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162908 ARi07E12 pGCAP10 NM_139067.2  
GAGGCGGCGGGAGGCGGCGGCCGCGGCGGCGGGAGGCGGCGGGAGGCGGGCGGAGGAGGA
HKR243924 ARiS109N12 pGCAP10 NM_139067.2  
GGGAGAAGATGGCGGTGCGGAAGAAGGACGGCGGCCCCAACGTGAAGTACTACGAGGCCG
HKR327326 RBb18F06 pKA1U5 NM_139067.2  
GGGGCGGCGGCGGGGCCCGAGCCGGAGAAGATGGCGGTGCGGAAGAAGGACGGCGGCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl