Prev. |  KEGG KO K11649 > 

RIKEN DNA Bank Human Resource - SMARCC1

Gene ID NCBI Gene 6599 |  KEGG hsa:6599
Gene Symbol SMARCC1
Protein Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1
Synonyms BAF155|CRACC1|Rsc8|SRG3|SWI3
Ortholog resource in our bank

  SMARCC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001482 IRAK003L18 pCMV-SPORT6 BC040242 NM_003074 Partial/var
HGX033651 IRAK084C03 pCMV-SPORT6 BC039843 NM_003074 Partial/var
HGX042816 IRAK107A16 pCMV-SPORT6 BC050564 NM_003074 Full/var
HGX056179 IRAK140H11 pCMV-SPORT6 BC065253 NM_003074 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR374099 RBd35E03 pGCAP10 NM_003074.3  
GACGCGCGCGGGGGTGCGCGCGGGAACGACCGGGAAACACCGCGAGGGCCGGGGTGGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl