Prev. |  KEGG KO K11727 > 

RIKEN DNA Bank Human Resource - SMARCA1

Gene ID NCBI Gene 6594 |  KEGG hsa:6594
Gene Symbol SMARCA1
Protein Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1
Synonyms ISWI|NURF140|SNF2L|SNF2L1|SNF2LB|SNF2LT|SWI|SWI2|hSNF2L
Ortholog resource in our bank

  SMARCA1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044353 IRAK110O17 pCMV-SPORT6 BC051825 NM_003069 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR188576 ARi71H08 pGCAP10 NM_003069.3  
GGGAAGCGGAGTGATTCCCCACCCCTGCTCCATCTAGCTCTTTCCAGTGCAGCCACTGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl