Prev. |  KEGG KO K15100 > 

RIKEN DNA Bank Human Resource - SLC25A1

Gene ID NCBI Gene 6576 |  KEGG hsa:6576
Gene Symbol SLC25A1
Protein Name solute carrier family 25 member 1
Synonyms CMS23|CTP|D2L2AD|SEA|SLC20A3
Ortholog resource in our bank

  SLC25A1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081000 IRAL002I08 pOTB7 BC008061 NM_005984 Full
HGY083978 IRAL009P18 pOTB7 BC004980 NM_005984 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE005755 W01A014G11 pENTR-TOPO IRAL002I08 BC008061 NM_005984  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072531 ARe81F11 pKA1U5 NM_005984.1  
GAGTCTCGGACCCGAAGCCGCCACAGGGCGCCCCGCCTCCCGCCCGCCATGCCCGCGCCC
HKR160974 ARi02H06 pGCAP10 NM_005984.1  
GGAGCGCGGAGTTCTGGAGTCTCGGACCCGAAGCCGCCACAGGGCGCCCCGCCTCCCGCC
HKR185631 ARi64B07 pGCAP10 NM_005984.1  
ACCGGCCGCCGCCGCCNCCGCGGACCGAGCGCGNANTTCTGNAGTCTCGNACCNANCNN
HKR203337 ARiS008F17 pGCAP10 NM_005984.1  
GGGCCGCCGCCGCCACCGCGGACCGAGCGCGGAGTTCTGGAGTCTCGGACCCGAAGCCGC
HKR222001 ARiS055A01 pGCAP10 NM_005984.1  
GGAGCGCGGAGTTCTGGAGTCTCGGACCCGAAGCCGCCACAGGGCGCCCCGCCTCCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl