DNA Bank Top |  KEGG KO K14640 > 

RIKEN DNA Bank Human Resource - SLC20A2

Gene ID NCBI Gene 6575 |  KEGG hsa:6575
Gene Symbol SLC20A2
Protein Name solute carrier family 20 member 2
Synonyms GLVR-2|GLVR2|IBGC1|IBGC2|IBGC3|MLVAR|PIT-2|PIT2|RAM1|Ram-1

Link

Ortholog resource in our bank

  SLC20A2

External database

human SLC20A2

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB01408 AxCAhGLVR2 Recombinant adenovirus expressing human GLVR2 gene    
RDB01407 pAxCAhGLVR2 Human GLVR2 cDNA, adenovirus vector    
RDB01406 pCAhGLVR2 Human GLVR2 cDNA    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018587 IRAK046H19 pBluescriptR BC028600 NM_006749

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE020549 W01A051G05 pENTR-TOPO IRAK046H19 BC028600 NM_006749  
HGE020551 W01A051G07 pENTR-TOPO IRAK046H19 BC028600 NM_006749  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR062507 ARe56E11 pKA1U5 NM_006749.3  
GACTCACGCTGCCGGCTCCGGAGGCGGCACGCGCCCCTGCGCTGCTCCGCTCCGGGGCTC
HKR323679 RBb09D07 pKA1U5 NM_006749.3  
GGCGCTTCCGGAAGCGGGCGACTCGCAGCTCCACGCGACGCCGAGGGGCTCCGCGCCGGG
HKR432516 RBdS081E20 pGCAP10 NM_006749.3  
GGGGGACCGGGAGAAGCGGGGACGCGGGGCCACTCACGCTGCCGGCTCCGGAGGCGGCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.02

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl