Prev. |  KEGG KO K14640 > 

RIKEN DNA Bank Human Resource - SLC20A1

Gene ID NCBI Gene 6574 |  KEGG hsa:6574
Gene Symbol SLC20A1
Protein Name solute carrier family 20 member 1
Synonyms GLVR1|Glvr-1|PIT1|PiT-1
Ortholog resource in our bank

  SLC20A1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010434 IRAK026B10 pCMV-SPORT6 BC019944 NM_005415
HGY102820 IRAL057A20 pDNR-LIB BC075818 NM_005415 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR368852 RBd22C04 pGCAP10 NM_005415.3  
GNAGTGATGGCTGCCGGCGCTCTCTGCGTGTNTNTNNNGNGCTGAACNCNNGNTGCTNCT
HKR373254 RBd33C06 pGCAP10 NM_005415.3  
GGGAGTGATGGCTGCCGGCGCTCTCTGCGTGGTTCTTCTTCTCGGCCGCTGAAACCCCCG
HKR378899 RBd47E03 pGCAP10 NM_005415.3  
GGGAGTGATGGCTGCCGGCGCTCTCTGCGTGGTTCTTCTTCTCGGCCGCTGAAACCCCCG
HKR403096 RBdS007M08 pGCAP10 NM_005415.3  
GAGTGATGGCTGCCGGCGCTCTCTGCGTGGTTCTTCTTCTCGGCCGCTGAAACCCCCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl