Prev. |  KEGG KO K13855 > 

RIKEN DNA Bank Human Resource - SLC4A2

Gene ID NCBI Gene 6522 |  KEGG hsa:6522
Gene Symbol SLC4A2
Protein Name solute carrier family 4 member 2
Synonyms AE2|BND3L|EPB3L1|HKB3|NBND3
Ortholog resource in our bank

  SLC4A2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018501 IRAK046E05 pBluescriptR BC028601 NM_003040 Partial/var
HGY082916 IRAL007E20 pOTB7 BC004893 NM_003040 Full/var
HGY089244 IRAL023B20 pOTB7 BC009434 NM_003040 Partial/var
HGY090579 IRAL026H11 pOTB7 BC009386 NM_003040 Partial/var
HGY091103 IRAL027M15 pOTB7 BC010069 NM_003040 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR442175 RBdS105H07 pGCAP10 NM_003040.3  
GACGCAGGGGGCTGGCCTGCCCGCGGCGCGGGGGAAAGTTGAGTTGGGAGAAGTTGGGAG
HKR461782 RBdS154H14 pGCAP10 NM_003040.3  
GACGCAGGGGGCTGGCCTGCCCGCGGCGCGGGGGAAAGTTGAGTTGGGAGAAGTTGGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl