Prev. |  KEGG KO K06519 > 

RIKEN DNA Bank Human Resource - SLC3A2

Gene ID NCBI Gene 6520 |  KEGG hsa:6520
Gene Symbol SLC3A2
Protein Name solute carrier family 3 member 2
Synonyms 4F2|4F2HC|4T2HC|CD98|CD98HC|MDU1|NACAE
Ortholog resource in our bank

  SLC3A2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07590 pTriEx-hCD98hc
RDB07591 pVAC-hCD98hc

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082979 IRAL007H11 pOTB7 BC001061 NM_002394 Full
HGY083923 IRAL009N11 pOTB7 BC003000 NM_001013251 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE007698 W01A019E02 pENTR-TOPO IRAL009N11 BC003000 NM_001013251  
HGE007700 W01A019E04 pENTR-TOPO IRAL009N11 BC003000 NM_001013251  
HGE007710 W01A019E14 pENTR-TOPO IRAL007H11 BC001061 NM_002394  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR181625 ARi54B01 pGCAP10 NM_001012661.1  
GGCAGATGCAGTAGCCGAAACTGCGCGGAGGCACAGAGGCCGGGGAGAGCGTTCTGGGTC
HKR364051 RBd10C03 pGCAP10 NM_001012661.1  
GAGAGGCCGCGCCTGCTGCTGAGCAGATGCAGTAGCCGAAACTGCGCGGAGGCACAGAGG
HKR365203 RBd13A03 pGCAP10 NM_001012661.1  
GGCATTGCGGCTTGGTTTTCTCACCCAGTGCATGTGGCAGGAGCGGTGAGATCACTGCCT
HKR405866 RBdS014L02 pGCAP10 NM_001012661.1  
GGCATTGCGGCTTGGTTTTCTCACCCANTGCATGTGGCAGGAGCGGTGAGATCACTGCCT
HKR416350 RBdS040O14 pGCAP10 NM_001012661.1  
GGCATTGCGGCTTGGTTTTCTCACCCAGTGCATGTGGCAGGAGCGGTGAGATCACTGCCT
HKR461957 RBdS154O21 pGCAP10 NM_001012661.1  
GAGATGCAGTAGCCGAAACTGCGCGGAGGCACAGAGGCCGGGGAGAGCGTTCTGGGTCCG
HKR471082 RBdS177L18 pGCAP10 NM_001012661.1  
GGCATGCGTCCTACGGNAGCGTGCTGGCTCACCGACCGCATTGCGGCTTGGTTTTCTCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.08.17

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl