Prev. |  KEGG KO K05618 > 

RIKEN DNA Bank Human Resource - SLC1A7

Gene ID NCBI Gene 6512 |  KEGG hsa:6512
Gene Symbol SLC1A7
Protein Name solute carrier family 1 member 7
Synonyms AAAT|EAAT5
Ortholog resource in our bank

  SLC1A7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091837 IRAL029J21 pOTB7 BC012119 NM_006671 Full
HGY093335 IRAL033F15 pOTB7 BC017242 NM_006671

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR322973 RBb07H05 pKA1U5 NM_006671.4  
GTTCCCTCTAAGGCGGCCACACGGGCATGGCCGCTGGGGCTGGCGACTGGTGTTTAGCAA
HKR430328 RBdS075N16 pGCAP10 NM_006671.6 full/var  
GAGGATTGTGGCTTCCCTCTAAGGCGGCCACACGGGCATGGCCGTGGGGCTGGCGACTGG
HKR433359 RBdS083G15 pGCAP10 NM_001287597.2 full cds  
GACACGGGCATGGCCGTGGGGCTGGCGACTGGTGTTTAGCAACTCCGACCACCTGCCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl