Prev. |  KEGG KO K03094 > 

RIKEN DNA Bank Human Resource - SKP1

Gene ID NCBI Gene 6500 |  KEGG hsa:6500
Gene Symbol SKP1
Protein Name S-phase kinase associated protein 1
Synonyms EMC19|OCP-II|OCP2|SKP1A|TCEB1L|p19A
Featured content Circadian clock (human)
Featured content Wnt signaling pathway (human)
Ortholog resource in our bank

  SKP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX019703 IRAK049E07 pCMV-SPORT6 BC025673 NM_170679
HGY090346 IRAL025O10 pOTB7 BC009839 NM_170679 Full
HGY094021 IRAL035A21 pDNR-LIB BC020798 NM_170679 Full
HGY100757 IRAL051O21 pDNR-LIB BC065730 NM_170679 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099204 M01C048A04 pDONR221 MGC13-F02 BC009839 NM_170679  
HGE099252 M01C048C04 pDONR221 MGC13-F02 BC009839 NM_170679  
HGE099300 M01C048E04 pDONR221 MGC13-F02 BC009839 NM_170679  
HGE099348 M01C048G04 pDONR221 MGC13-F02 BC009839 NM_170679  
HGE099396 M01C048I04 pDONR221 MGC13-F02 BC009839 NM_170679 done
HGE099444 M01C048K04 pDONR221 MGC13-F02 BC009839 NM_170679  
HGE099492 M01C048M04 pDONR221 MGC13-F02 BC009839 NM_170679  
HGE099540 M01C048O04 pDONR221 MGC13-F02 BC009839 NM_170679  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR051630 ARe29B06 pKA1U5 NM_006930.3  
GGCTGTAGTGGCTTCGTCTTCGGTTTTTCTCTTCCTTCGCTAACGCCTCCCGGCTCTCGT
HKR068551 ARe71G07 pKA1U5 NM_006930.3  
GGCTGTAGTGGCTTCGTCTTCGGTTTTTCTCTTCCTTCGCTAACGCCTCCCGGCTCTCGT
HKR070853 ARe77C05 pKA1U5 NM_006930.3  
GGCTGTAGTGGCTTCGTCTTCGGTTTTTCTCTTCCTTCGCTAACGCCTCCCGGCTCTCGT
HKR078546 ARe96G02 pKA1U5 NM_006930.3  
GGCTGTAGTGGCTTCGTCTTCGGTTTTTCTCTTCCTTCGCTAACGCCTCCCGGCTCTCGT
HKR167351 ARi18G07 pGCAP10 NM_006930.3  
GGCTGTAGTGGCTTCGTCTTCGGTTTTTCTCTTCCTTCGCTAACGCCTCCCGGCTCTCGT
HKR169278 ARi23D06 pGCAP10 NM_006930.3  
GGCTGTAGTGGCTTCGTCTTCGGTTTTTCTCTTCCTTCGCTAACGCCTCCCGGCTCTCGT
HKR179275 ARi48D03 pGCAP10 NM_006930.3  
GAGACGCCGCGCCGCGCTGCGACGCTGTAGTGGCTTCGTCTTCGGTTTTTCTCTTCCTTC
HKR182926 ARi57F06 pGCAP10 NM_006930.3  
GGCTGTAGTGGCTTCGTCTTCGGTTTTTCTCTTCCTTCGCTAACGCCTCCCGGCTCTCGT
HKR185303 ARi63E07 pGCAP10 NM_006930.3  
GGTAGTGGCTTCGTCTTCGGTTTTTCTCTTCCTTCGCTAACGCCTCCCGGCTCTCGTCAG
HKR277951 ARiS194O15 pGCAP10 NM_006930.3  
GGTAGTGNCTTCGTCTTCGGTTTTTCTCTTCCTTCGCTAACGCCTCCCGGCTCTCGTCAG
HKR344002 RBb60A02 pGCAP1 NM_006930.3  
GGTAGTGGCTTCGTCTTCGGTTTTTCTCTTCCTTCGCTAACGCCTCCCGGCTCTCGTCAG
HKR365680 RBd14D08 pGCAP10 NM_006930.3  
GGCTGTAGTGGCTTCGTCTTCGGTTTTTCTCTTCCTTCGCTAACGCCTCCCGGCTCTCGT
HKR371329 RBd28F09 pGCAP10 NM_006930.3  
TGGGCTGTAGTGGCTTCGTCTTCGGTTTTTCTCTTCCTTCGCTAACGCCTCCCGGCTCTC
HKR375352 RBd38G08 pGCAP10 NM_006930.3  
GGTAGTGGCTTCGTCTTCGGTTTTTCTCTTCCTTCGCTAACGCCTCCCGGCTCTCGTCAG
HKR376001 RBd40A01 pGCAP10 NM_006930.3  
GAGACGCCGCGCCGCGCTGCGACGCTGTAGTGGCTTCGTCTTCGGTTTTTCTCTTCCTTC
HKR382152 RBd55G08 pGCAP10 NM_006930.3  
GGTAGTGGCTTCGTCTTCGGTTTTTCTCTTCCTTCGCTAACGCCTCCCGGCTCTCGTCAG
HKR433514 RBdS083N02 pGCAP10 NM_006930.3  
GGCTGTAGTGGCTTCGTCTTCGGTTTTTCTCTTCCTTCGCTAACGCCTCCCGGCTCTCGT
HKR441834 RBdS104J18 pGCAP10 NM_006930.3  
GGCCGCGCCGCGCTGCGACGCTGTAGTGGCTTCGTCTTCGGTTTTTCTCTTCCTTCGCTA
HKR471110 RBdS177M22 pGCAP10 NM_006930.3  
GGCTGTAGTGGCTTCGTCTTCGGTTTTTCTCTTCCTTCGCTAACGCCTCCCGGCTCTCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl