Prev. |  KEGG KO K18499 > 

RIKEN DNA Bank Human Resource - SKIL

Gene ID NCBI Gene 6498 |  KEGG hsa:6498
Gene Symbol SKIL
Protein Name SKI like proto-oncogene
Synonyms SNO|SnoA|SnoI|SnoN
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Ortholog resource in our bank

  SKIL

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY053221 IRAK133A21 pBluescript BC059386 NM_005414

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE038984 W01A097H16 pENTR-TOPO IRAK133A21 BC059386 NM_005414  
HGE038986 W01A097H18 pENTR-TOPO IRAK133A21 BC059386 NM_005414  
HGE038988 W01A097H20 pENTR-TOPO IRAK133A21 BC059386 NM_005414  
HGE038990 W01A097H22 pENTR-TOPO IRAK133A21 BC059386 NM_005414  
HGE038992 W01A097H24 pENTR-TOPO IRAK133A21 BC059386 NM_005414  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR362434 RBd06B10 pGCAP10 NM_005414.2  
GAGAGGGCTGTGTGTAGCGATGTGTGTGGGGTTCGGAGCCGCGCCGGCACAGCCGAAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl