Prev. |  KEGG KO K19473 > 

RIKEN DNA Bank Human Resource - SIX3

Gene ID NCBI Gene 6496 |  KEGG hsa:6496
Gene Symbol SIX3
Protein Name SIX homeobox 3
Synonyms HPE2
Ortholog resource in our bank

  SIX3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR277607 ARiS194A07 pGCAP10 NM_005413.3  
CGGCCGGCCNATGTCCCTCCTCCTGGTCCTCATCGCCCCTCTCCTCCTCTTCCTCCCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl