RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - ST8SIA1

Gene ID	NCBI Gene 6489 \| KEGG hsa:6489
Gene Symbol	ST8SIA1
Protein Name	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
Synonyms	GD3S\|SIAT8\|SIAT8-A\|SIAT8A\|ST8SiaI

Ortholog resource in our bank

  ST8SIA1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR334874	RBb37D02	pGCAP1	NM_003034.3
HKR334874	TGGTGAACTTCGCTCTGCACTTCTTCTCGCTGCTGCCACGNTGAGAAAGGATGTGTTTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl