Prev. |  KEGG KO K00781 > 

RIKEN DNA Bank Human Resource - ST3GAL3

Gene ID NCBI Gene 6487 |  KEGG hsa:6487
Gene Symbol ST3GAL3
Protein Name ST3 beta-galactoside alpha-2,3-sialyltransferase 3
Synonyms EIEE15|MRT12|SIAT6|ST3GALII|ST3Gal III|ST3GalIII|ST3N
Ortholog resource in our bank

  ST3GAL3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE019676 W01A049D04 pENTR-TOPO IRAK098H13 BC050380 NM_006279 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048009 ARe20A09 pKA1U5 NM_006279.2  
GGTCCCCACTATGGCGGCGCCCATGCAGCCCAGCGCGATTGTGGGCTCCCGCCGGGGTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl