Prev. |  KEGG KO K04506 > 

RIKEN DNA Bank Human Resource - SIAH1

Gene ID NCBI Gene 6477 |  KEGG hsa:6477
Gene Symbol SIAH1
Protein Name siah E3 ubiquitin protein ligase 1
Synonyms SIAH1A
Featured content Wnt signaling pathway (human)
Ortholog resource in our bank

  SIAH1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025944 IRAK064O08 pCMV-SPORT6 BC035562 NM_003031 Full
HGX008433 IRAK021B09 pCMV-SPORT6 BC018193 NM_003031 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR453181 RBdS132P21 pGCAP10 NM_003031.3  
GACCGGGGTCCGAGGCGCGCTCTCCGCCCACAGAAATGAGCCGTCAGACTGCTACAGCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl