Prev. |  KEGG KO K00600 > 

RIKEN DNA Bank Human Resource - SHMT2

Gene ID NCBI Gene 6472 |  KEGG hsa:6472
Gene Symbol SHMT2
Protein Name serine hydroxymethyltransferase 2
Synonyms GLYA|HEL-S-51e|SHMT
Ortholog resource in our bank

  SHMT2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX035675 IRAK089D03 pCMV-SPORT6 BC044211 NM_005412 Full
HGX027748 IRAK069G04 pCMV-SPORT6 BC032584 NM_005412 Full/var
HGY089383 IRAL023H15 pOTB7 BC008711 NM_005412 Partial/var
HGY091458 IRAL028K18 pOTB7 BC011911 NM_005412

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR079348 ARe98G04 pKA1U5 NM_005412.4  
GGCATGCGTTCTCCGAACGGTCTTCTTCCGACAGCTTGCTGCCCTAGACCAGAGTTGGTG
HKR172128 ARi30F08 pGCAP10 NM_005412.4  
GCTTCTTCCGACAGCTTGCTGCCCTAGACCAGAGTTGGTGGCTGGACCTCCTGCGACTTC
HKR339259 RBb48C11 pGCAP1 NM_005412.4  
GCTCCGAACGGTCTTCTTCCGACAGCTTGCTGCCCTAGACCAGAGTTGGTGGCTGGACCT
HKR406277 RBdS015L13 pGCAP10 NM_005412.4  
GGGTCTTCTTCCGACAGCTTGCTGCCCTAGACCAGAGTTGGTGGCTGGACCTCCTGCGAC
HKR428261 RBdS070K21 pGCAP10 NM_005412.4  
GCTTCTTCCGACAGCTTGCTGCCCTAGACCAGAGTTGGTGGCTGGACCTCCTGCGACTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl