Prev. |  KEGG KO K00600 > 

RIKEN DNA Bank Human Resource - SHMT1

Gene ID NCBI Gene 6470 |  KEGG hsa:6470
Gene Symbol SHMT1
Protein Name serine hydroxymethyltransferase 1
Synonyms CSHMT|SHMT
Ortholog resource in our bank

  SHMT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031244 IRAK078B20 pCMV-SPORT6 BC038598 NM_004169 Full
HGY089762 IRAL024G18 pOTB7 BC007979 NM_004169 Full/var
HGY092866 IRAL032C18 pDNR-LIB BC022874 NM_148918 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE022030 W01A055B06 pENTR-TOPO IRAL032C18 BC022874 NM_148918  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR179705 ARi49E09 pGCAP10 NM_004169.3  
GGCGGCGGTGCGCGGGGCGTTGGGTCAGCGGGTCTGGGACTGGTGGCACCGGCGGCGGCG
HKR205273 ARiS013D01 pGCAP10 NM_004169.3  
GAGCGGCTGGTCACGTGGCTGGCCCGCGGCGGTGCGCGGGGCGTTGGGTCAGCGGGTCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl