Prev. |  KEGG KO K06279 > 

RIKEN DNA Bank Human Resource - SHC1

Gene ID NCBI Gene 6464 |  KEGG hsa:6464
Gene Symbol SHC1
Protein Name SHC adaptor protein 1
Synonyms SHC|SHCA
Ortholog resource in our bank

  SHC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04644 pAxCALNLhSHC1(reverse) Shuttle vector to generate rAd expressing human SHC1
RDB04648 pAxCALNLhSHC1(forward) Shuttle vector to generate rAd expressing human SHC1

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY092104 IRAL030E08 pOTB7 BC014158 NM_183001 Partial/var
HGY097024 IRAL042J08 pOTB7 BC033925 NM_183001 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042481 ARe06D09 pKA1U5 NM_003029.4  
GGAGTGTAATAAAGTTTCTCCAGGGAGGCAGGGCCCGGGGAGAAAGTTGGAGCGGTAACC
HKR070082 ARe75D10 pKA1U5 NM_003029.4  
GGTCTGGGTCTGAGCTGGGGAGCGGAAGCCACTTGTCCCTCTCCCTCCCCAGGACTTCTG
HKR234312 ARiS085M24 pGCAP10 NM_003029.4  
GACTTGTCCCTCTCCCTCCCCAGGACTTCTGTGACTCCTGGGCCACAGAGGTCCAACCAG
HKR390009 RBd75A09 pGCAP10 NM_003029.4  
GGGAGCGGTAACCTAAGCTGGCAGTGGCGTGATCCGGCACCAAATCGGCCCGCGGTGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl