Prev. | 

RIKEN DNA Bank Human Resource - SHB

Gene ID NCBI Gene 6461 |  KEGG hsa:6461
Gene Symbol SHB
Protein Name SH2 domain containing adaptor protein B
Synonyms bA3J10.2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072132 ARe80F12 pKA1U5 NM_003028.2  
GGGCAAGAACTTGAACTTGGCGTCGGGAGCGGGCGCCCCGGACGCCCCCCGCCGGGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl