Prev. |  KEGG KO K11247 > 

RIKEN DNA Bank Human Resource - SH3GL1

Gene ID NCBI Gene 6455 |  KEGG hsa:6455
Gene Symbol SH3GL1
Protein Name SH3 domain containing GRB2 like 1, endophilin A2
Synonyms CNSA1|EEN|SH3D2B|SH3P8
Ortholog resources KEGG ortholog (KEGG orthology K11247) in the DNA Bank
Featured content Endocytosis (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001748 IRAK004G04 pCMV-SPORT6 BC001270 NM_003025
HGY082985 IRAL007H17 pOTB7 BC014387 NM_003025 Partial
HGY083080 IRAL007L16 pOTB7 BC000089 NM_003025 Partial
HGY083144 IRAL007O08 pOTB7 BC001094 NM_003025 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR061233 ARe53B09 pKA1U5 NM_003025.2  
GGACTGCTGAGGCGCGCAGAGGGTCGGCGGCGCCCGGGAGCCTGTCGCTGGCGCGGTCCG
HKR264783 ARiS161P23 pGCAP10 NM_003025.2  
GGCGCGAGCGGCTGAGGCGGCGCCGGGGCGGGCGCGGAGCTGGCAAGCGGGTGGCGGAGG
HKR341701 RBb54E05 pGCAP1 NM_003025.2  
GCTGGCCGCGCGGGCGCGCGAGCGGCTGANGCGGCNCCGGGGCGGGCGCGGAGCTGGCAA
HKR362929 RBd07F09 pGCAP10 NM_003025.2  
GGAGGCGGCGCCGGGGCGGGCGCGGAGCTGGCAAGCGGGTGGCGGAGGCGGCGCCGACGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl