Prev. |  KEGG KO K20045 > 

RIKEN DNA Bank Human Resource - ITSN1

Gene ID NCBI Gene 6453 |  KEGG hsa:6453
Gene Symbol ITSN1
Protein Name intersectin 1
Synonyms ITSN|SH3D1A|SH3P17
Ortholog resource in our bank

  ITSN1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033066 IRAK082L02 pCMV-SPORT6 BC039036 NM_003024 Partial/var
HGX047644 IRAK119B20 pCMV-SPORT6 BC058925 NM_003024 Partial/var
HGY103503 IRAL058M15 pOTB7 BC073744 NM_003024 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR166927 ARi17F07 pGCAP10 NM_001001132.1  
GCTGCGTCCCTCCCAGCGGCGCGTGAGCGGCACTGATTTGTCCCTGGGGCGGCAGCGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl