Prev. | 

RIKEN DNA Bank Human Resource - SH3BGRL

Gene ID NCBI Gene 6451 |  KEGG hsa:6451
Gene Symbol SH3BGRL
Protein Name SH3 domain binding glutamate rich protein like
Synonyms HEL-S-115|SH3BGR
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY092891 IRAL032D19 pDNR-LIB BC016709 NM_003022 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE003877 W01A009L13 pENTR-TOPO IRAL032D19 BC016709 NM_003022  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR247374 ARiS118H06 pGCAP10 NM_003022.1  
GAGCTGGATTCCAGCCATTGCTGCAGCTGCTCCACAGCCCTTTTCAGGACCCAAACAACC
HKR325369 RBb13H01 pKA1U5 NM_003022.1  
GGCAGCTGCTCCACAGCCCTTTTCAGGACCCAAACAACCGCAGCCGCTGTTCCCAGGATG
HKR405867 RBdS014L03 pGCAP10 NM_003022.1  
GAACCGCTGTTTCAGCCCCTAGCTGGATTCCAGCCATTGCTGCAGCTGCTCCACAGCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl