Prev. |  KEGG KO K16365 > 

RIKEN DNA Bank Human Resource - SGTA

Gene ID NCBI Gene 6449 |  KEGG hsa:6449
Gene Symbol SGTA
Protein Name small glutamine rich tetratricopeptide repeat containing alpha
Synonyms SGT|alphaSGT|hSGT
Ortholog resource in our bank

  SGTA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080518 IRAL001E22 pOTB7 BC000390 NM_003021 Full
HGY083821 IRAL009J05 pOTB7 BC002989 NM_003021 Full
HGY084725 IRAL011N13 pOTB7 BC005165 NM_003021 Full
HGY090757 IRAL026O21 pOTB7 BC008885 NM_003021 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR067676 ARe69D04 pKA1U5 NM_003021.3  
ATCCTGTGGGGGGCCGGGGCCGGGCGGCACCGCGGTGCGCAAGCGCAACCGTCGGTGGGT
HKR332153 RBb30G09 pGCAP1 NM_003021.3  
GGGGGCCGGGCGGCACCGCGGTGCGCAAGCGCAACCGTCGGTGGGTCGGGGATCGGTCGC
HKR370097 RBd25E01 pGCAP10 NM_003021.3  
GGCCGGGGCCGGGCGGCACCGCGGTGCGCAAGCGCAACCGTCGGTGGGTCGGGGATCGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl