Prev. | Human A to Z list > S > 

RIKEN DNA Bank Human Resource - SGK1

Gene ID (NCBI) 6446
Gene Symbol SGK1
Protein Name serum/glucocorticoid regulated kinase 1
Synonyms SGK
Databases KEGG hsa:6446 |  NCBI Gene 6446
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content Ortholog resources in the DNA Bank (KEGG orthology K13302)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001612 IRAK004A12 pCMV-SPORT6(a) BC001263 NM_005627 Full

(1) Please refer Vector Information and Library Method Overviews at MGC.
(a)Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE006868 W01A017C20 pENTR-TOPO IRAK004A12 BC001263 NM_005627  
HGE006870 W01A017C22 pENTR-TOPO IRAK004A12 BC001263 NM_005627  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045708 ARe14E12 pKA1U5 NM_005627.3  
GATACGCCGAGCCGGTCTTTGAGCGCTAACGTCTTTCTGTCTCCCCGCGGTGGTGATGAC
HKR062075 ARe55D03 pKA1U5 NM_005627.3  
GGCAGCATACGCCGAGCCGGTCTTTGAGCGCTNNCGTTCTTTCTGTCTCCCCGCGGTGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.01.21

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180829.pl