Prev. |  KEGG KO K12566 > 

RIKEN DNA Bank Human Resource - SGCB

Gene ID NCBI Gene 6443 |  KEGG hsa:6443
Gene Symbol SGCB
Protein Name sarcoglycan beta
Synonyms A3b|LGMD2E|LGMDR4|SGC
Ortholog resource in our bank

  SGCB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY042408 IRAK106A08 pBluescript BC048972 NM_000232 Partial/var
HGY095094 IRAL037M06 pDNR-LIB BC020709 NM_000232 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE014497 W01A036E01 pENTR-TOPO IRAL037M06 BC020709 NM_000232  
HGE014499 W01A036E03 pENTR-TOPO IRAL037M06 BC020709 NM_000232  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR191773 ARi79H05 pGCAP10 NM_000232.4  
GACAGTCGGGCGGGGAGCTCGGCGGCGGCGGGCGCGGGAAGATGGCGGCAGCGGCGGCGG
HKR384857 RBd62C09 pGCAP10 NM_000232.4  
GGGCGGCGGCGGGCGCGGGAAGATGGCGGCAGCGGCGGCGGCGGCTGCAGAACAGCAAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl