Prev. |  KEGG KO K12897 > 

RIKEN DNA Bank Human Resource - TRA2B

Gene ID NCBI Gene 6434 |  KEGG hsa:6434
Gene Symbol TRA2B
Protein Name transformer 2 beta homolog
Synonyms Htra2-beta|PPP1R156|SFRS10|SRFS10|TRA2-BETA|TRAN2B
Ortholog resource in our bank

  TRA2B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001231 IRAK003B07 pCMV-SPORT6 BC000160 NM_004593 Full
HGY080533 IRAL001F13 pOTB7 BC000451 NM_004593 Full
HGY088741 IRAL021O05 pDNR-LIB BC005898 NM_004593 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE014294 W01A035M06 pENTR-TOPO IRAK003B07 BC000160 NM_004593  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR330577 RBb26H09 pGCAP1 NM_004593.1  
GAGAGCCCGTGCGGAGGCGGTGCGGAGCATTTCGGCTCTGAGCGGCTGGGCGACCGGCGC
HKR333703 RBb34E07 pGCAP1 NM_004593.1  
GTGCTCGCTTCGGCAGCACATATACTAAAATTGGAACGATACAGTAGAAGATTAGCATGG
HKR366008 RBd15A08 pGCAP10 NM_004593.1  
AGGAGGATGGAGAGCTGCCCAAGACAGGGATCAGATTTATAGAAGGCGGTCACCTTCTCC
HKR372099 RBd30E03 pGCAP10 NM_004593.1  
GAATTTACATGGGGAGACCTACCTATGGCAGCTCTCGCCGTCGGGATTACTATGACAGAG
HKR375370 RBd38H02 pGCAP10 NM_004593.1  
GNTTTCCGACCGGCTGGGNNCCTGGNAANGGAGCCGCCGCCTGGTCTGCACCCTCCTTAT
HKR388497 RBd71E01 pGCAP10 NM_004593.1  
TGAGAGCCCGTGCGGAGGCGGTGCGGAGCATTTCGGCTCTGAGCGGCTGGGCGACCGGCG
HKR398836 RBd97B12 pGCAP10 NM_004593.1  
GAGAGCCCGTGCGGAGGCGGTGCGGAGCATTTCGGCTCTGAGCGGCTGGGCGACCGGCGC
HKR399325 RBd98F05 pGCAP10 NM_004593.1  
TGTGCTCGCTTCGGCAGCACATATACTAAAATTGGAACGATACAGAGAAGATTAGCATGG
HKR420410 RBdS051A10 pGCAP10 NM_004593.1  
GTGCTCGCTTCGGCAGCACATATACTAAAATTGGAACGATACAGAGAAGATTAGCATGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl