Prev. |  KEGG KO K12896 > 

RIKEN DNA Bank Human Resource - SRSF7

Gene ID NCBI Gene 6432 |  KEGG hsa:6432
Gene Symbol SRSF7
Protein Name serine and arginine rich splicing factor 7
Synonyms 9G8|AAG3|SFRS7
Ortholog resource in our bank

  SRSF7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001321 IRAK003F01 pCMV-SPORT6 BC000997 NM_001031684 Full
HGY081269 IRAL003C21 pOTB7 BC017369 NM_001031684 Full
HGY094120 IRAL035E24 pDNR-LIB BC022328 NM_001031684
HGY094233 IRAL035J17 pDNR-LIB BC017908 NM_001031684 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE019378 W01A048H10 pENTR-TOPO IRAL035E24 BC022328 NM_001031684  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR073374 ARe83H06 pKA1U5 NM_001031684.2  
GGTGCCGCCGGGACTCTTGGCGGGTGAAGGTGTGTGTCAGCTTTTGCGTCACTCGAGCCC
HKR332972 RBb32H04 pGCAP1 NM_001031684.2  
GGTAGTGCCGCCGGGACTCTTGGCGGGTGAAGGTGTGTGTCAGCTTTTGCGTCACTCGAG
HKR336006 RBb40A06 pGCAP1 NM_001031684.2  
GGTAGTGCCGCCGGGAACTCTTGGCGGGTGAAGGTGTGTGTCAGCTTTTGCGTCACTCGA
HKR337675 RBb44D03 pGCAP1 NM_001031684.2  
GGTAGTGCCGCCGGGACTCTTGGCGGGTGAAGGTGTGTGTCAGCTTTTGCGTCACTCGAG
HKR343227 RBb58B03 pGCAP1 NM_001031684.2  
GAGTGCCGCCGGGACTCTTGGCGGGTGAAGGTGTGTGTCAGCTTTTGCGTCACTCGAGCC
HKR374875 RBd37D03 pGCAP10 NM_001031684.2  
GAGTGCCGCCGGGACTCTTGGCGGGTGAAGGTGTGTGTCAGCTTTTGCGTCACTCGAGCC
HKR376125 RBd40F05 pGCAP10 NM_001031684.2  
GGTAGTGCCGCCGGGACTCTTGGCGGGTGAAGGTGTGTGTCAGCTTTTGCGTCACTCGAG
HKR384977 RBd62H09 pGCAP10 NM_001031684.2  
GAGTGCCGCCGGGACTCTTGGCGGGTGAAGGTGTGTGTCAGCTTTTGCGTCACTCGAGCC
HKR389655 RBd74C07 pGCAP10 NM_001031684.2  
GAGTGCCGCCGGGACTCTTGGCGGGTGAAGGTGTGTGTCAGCTTTTGCGTCACTCGAGCC
HKR399236 RBd98B12 pGCAP10 NM_001031684.2  
GAGTGCCGCCGGGACTCTTGGCGGGTGAAGGTGTGTGTCAGCTTTTGCGTCACTCGAGCC
HKR402839 RBdS007B15 pGCAP10 NM_001031684.2  
ATGGTAGTGCCGCCGGGACTCTTGGCGGGTGAAGGTGTGTGTCAGCTTTTGCGTCACTCG
HKR408964 RBdS022G20 pGCAP10 NM_001031684.2  
GGTAGTGCCGCCGGGACTCTTGGCGGGTGAAGGTGTGTGTCAGCTTTTGCGTCACTCGAG
HKR433423 RBdS083J07 pGCAP10 NM_001031684.2  
GGTAGTGCCGCCGGGACTCTTGGCGGGTGAAGGTGTGTGTCAGCTTTTGCGTCACTCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl